Part I.

Here are three partial nucleotide sequences for a gene in humans (each sequence is from different parts of the same gene). Each partial sequence below contains a mutation.

  o the gene product
  o the sequence of the gene product
  o the mutations, and
  o the class of mutation to which each belongs

Sequence 1
tcttgactcttgagcatggtgctaggttttggggctcccactgaagggga gagcccagggagggaagggaagaatgggcagatgggagggcagccagctt ctgctcactccaggcacagccatgggagattcggagatggcagtctttgc tgccgccccctacctgcgcaagtcagagaaggagcggctagaagcgcaga ccaggccttttgacctcaagaaggatgtcttcgtgcctgatgacaaacag gagtttgtcaaggccaagatcgtgtctcgagagggtggcaaagtcactgc cgagactgagtatggcaaggtgggtgtcaggctgatgtgagagtccaccc tggccacctgtacacctgggtggacaga

Sequence 2
cttgctggtctccagtagtattgttcactgcccaataagcccctgtcttc acagcggagaatccggagcagggaagacactcaacaccaagagggtcatc cagtactttgctgttattgcagccattggggaccgcagcaagaaggacca gagcccgggcaaggtaggcctgctgccctccaaggtcctgtaccgcag

Sequence 3
agtcatctctttaccaactttgctacttgccttttccttccagaggctga caagtctgcctacctcatggggctgaactcagccgacctgctcaaggggc tgtgccaccctctggtgaaagtgggcaatgagtacgtcaccaaggggcag aatgtccagcaggtgggtccatcttcagatgataat

Finally, and most importantly, what are the implications of the mutations for each patient?

Part II.

How do the mutations alter the function of the protein? Let’s take a look at where in the native protein the mutations occur.
Last modified: Monday, December 19, 2011, 9:18 AM